IT Disaster Recovery Planning For Dummies
Cover of IT Disaster Recovery Planning for Dummies book with cartoon character and key subtitle text.
Explore Book
Buy NowSubscribe on Perlego
IT Disaster Recovery Planning For Dummies
Cover of IT Disaster Recovery Planning for Dummies book with cartoon character and key subtitle text.Explore Book
Buy NowSubscribe on Perlego
Bioinformatics is the marriage of molecular biology and information technology. Websites direct you to basic bioinformatics data and get down to specifics in helping you analyze DNA/RNA and protein sequences.

All of this data comes at you in several formats, so becoming familiar with various format types helps you know how to interpret and store the data.

Where to find bioinformatics data

Bioinformatics combines information technology and molecular biology, so it makes sense that the internet is the main arena for pursuing bioinformatics information.

The following list offers links to helpful websites around the world and the areas that they specialize in.

Websites for analyzing DNA/RNA sequences

The bioinformatics websites in the following list offer help in analyzing DNA and RNA sequences. And, in the marriage of information technology and molecular biology that is bioinformatics, this type of analysis is what it’s all about.

Websites for analyzing protein sequences

With bioinformatics you can explore molecular biology using information technology. The links to the websites in the following list focus on protein sequences. Some offer searchable databases, others help you investigate a single protein; all are helpful.

Bioinformatics data formats

When you’re using the internet to help with your bioinformatics project, you come across data in all sorts of different formats. The following table can help you understand common bioinformatics formats and what you can and cannot do with them.

Format Name Description
RAW Sequence format that doesn’t contain any header. Spaces and
numbers are usually tolerated.
FASTA This is the default format. Sequence format that contains a
header line and the sequence: >name
AGCTGTGTGGGTTGGTGGGTT
PIR Sequence format that’s similar to FASTA but less common
MSF Multiple sequence alignment format
CLUSTAL Multiple sequence alignment format (works with T-Coffee)
TXT Text format
GIF, JPEG, PNG, PDF Graphic formats. Do not use them to store important
information.

About This Article

This article is from the book: 

About the book author:

Jean-Michel Claverie is Professor of Medical Bioinformatics at the School of Medicine of the Université de la Méditerranée, and a consultant in genomics and bioinformatics. He is the founder and current head of the Structural & Genomic Information Laboratory, located in Marseilles, a sunny city on the Mediterranean coast of France. Using science as a pretext to travel, Jean-Michel has held positions in Paris (France), Sherbrooke (PQ, Canada), the Salk Institute (La Jolla, CA), the Pasteur Institute (Paris), Incyte pharmaceutical (Palo Alto, CA); and the National Center for Biotechnology Information (Bethesda, MD). He has used computers in biology since the early days –– his Ph.D. work involved modeling biochemical reactions by programming an 8K Honeywell 516 computer right from the console switches! Although he has no clear recollection of it, he has been credited with introducing the French word “bioinformatique” in the late eighties, before involuntarily coining the catchy “bioinformatics” by mistranslating it while giving a talk in English!
Jean-Michel’s current research interests are in microbial and structural genomics, and in the development of bioinformatic methods for the prediction of gene function. He is the author or coauthor of more than 150 scientific publications, and a member of numerous international review panels and scientific councils. In his spare time, he enjoys the relaxed pace of life in Marseilles, with his wife Chantal and their two sons, Nicholas and Raphael.

Cedric Notredame is a researcher at the French National Centre for Scientific Research. Cedric has used and abused the facilities offered by science to wander around Europe. After a Ph.D. at EMBL (Heidelberg, Germany) and at the European Bioinformatics Institute (Cambridge, UK) under the supervision of Des Higgins (yes, the ClustalW guy), Cedric did a post-doc at the National Institute of Medical Research (London, UK), in the lab of Willie Taylor and under the supervision of Jaap Heringa. He then did a post-doc in Lausanne (Switzerland) with Phillip Bucher, and remained involved with the Swiss Institute of Bioinformatics for several years. Having had his share of rain, snow, and wind, Cedric has finally settled in Marseilles, where the sun and the sea are simply warmer than any other place he has lived in.
Cedric dedicates most of his research to the multiple sequence alignment problem and its many applications in biology. His friends claim that his entire life (past, present, future) is somehow stuffed into the T-Coffee multiple-sequence alignment package. When he is not busy dismantling T-Coffee and brewing new sequences, Cedric enjoys life in the company of his wife, Marita.