Bioinformatics For Dummies book cover

Bioinformatics For Dummies

By: Jean-Michel Claverie and Cedric Notredame Published: 12-18-2006

Were you always curious about biology but were afraid to sit through long hours of dense reading? Did you like the subject when you were in high school but had other plans after you graduated? Now you can explore the human genome and analyze DNA without ever leaving your desktop!

Bioinformatics For Dummies is packed with valuable information that introduces you to this exciting new discipline. This easy-to-follow guide leads you step by step through every bioinformatics task that can be done over the Internet. Forget long equations, computer-geek gibberish, and installing bulky programs that slow down your computer. You’ll be amazed at all the things you can accomplish just by logging on and following these trusty directions. You get the tools you need to:

  • Analyze all types of sequences
  • Use all types of databases
  • Work with DNA and protein sequences
  • Conduct similarity searches
  • Build a multiple sequence alignment
  • Edit and publish alignments
  • Visualize protein 3-D structures
  • Construct phylogenetic trees

This up-to-date second edition includes newly created and popular databases and Internet programs as well as multiple new genomes. It provides tips for using servers and places to seek resources to find out about what’s going on in the bioinformatics world. Bioinformatics For Dummies will show you how to get the most out of your PC and the right Web tools so you’ll be searching databases and analyzing sequences like a pro!

Articles From Bioinformatics For Dummies

5 results
5 results
Bioinformatics For Dummies Cheat Sheet

Cheat Sheet / Updated 04-12-2022

Bioinformatics is the marriage of molecular biology and information technology. Websites direct you to basic bioinformatics data and get down to specifics in helping you analyze DNA/RNA and protein sequences. All of this data comes at you in several formats, so becoming familiar with various format types helps you know how to interpret and store the data.

View Cheat Sheet
Bioinformatics Data Formats

Article / Updated 03-26-2016

When you're using the Internet to help with your bioinformatics project, you come across data in all sorts of different formats. The following table can help you understand common bioinformatics formats and what you can and cannot do with them. Format Name Description RAW Sequence format that doesn't contain any header. Spaces and numbers are usually tolerated. FASTA This is the default format. Sequence format that contains a header line and the sequence: >name AGCTGTGTGGGTTGGTGGGTT PIR Sequence format that's similar to FASTA but less common MSF Multiple sequence alignment format CLUSTAL Multiple sequence alignment format (works with T-Coffee) TXT Text format GIF, JPEG, PNG, PDF Graphic formats. Do not use them to store important information.

View Article
Where to Find Bioinformatics Data

Article / Updated 03-26-2016

Bioinformatics combines information technology and molecular biology, so it makes sense that the Internet is the main arena for pursuing bioinformatics information. The following list offers links to helpful Web sites around the world and the areas that they specialize in: Ensembl: The Human Genome GenBank/DDBJ/EMBL: Nucleotide sequence PubMed: Literature references Swiss Institiute of Bioinformatics: Annotated protein sequences InterProScan: Protein domains OMIM: Genetic diseases GenomeNet: Metabolic pathways

View Article
Bioinformatics Web Sites for Analyzing DNA/RNA Sequences

Article / Updated 03-26-2016

The bioinformatics Web sites in the following list offer help in analyzing DNA and RNA sequences. And, in the marriage of information technology and molecular biology that is bioinformatics, this type of analysis is what it's all about. Webcutter: Restriction map GenomeScan: Gene discovery blastn, tblastn, blastx: Database search The Genome Browser: Browse the ultimate data! Mfold: RNA structure prediction

View Article
Bioinformatics Web Sites for Analyzing Protein Sequences

Article / Updated 03-26-2016

With bioinformatics you can explore molecular biology using information technology. The links to the Web sites in the following list focus on protein sequences. Some offer searchable databases, others help you investigate a single protein; all are helpful: BLAST: Database homology search SRS: Database search Entrez: Database search InterProScan: Find protein domains ExPASy: Analyze a protein ClustalW: Multiple sequence alignment T-Coffee: Evaluate multiple alignment Jalview: Multiple alignment editor PSIPRED: Secondary structure prediction Cn3D: Display and spin 3-D structures

View Article