Bioinformatics Data Formats
When you're using the Internet to help with your bioinformatics project, you come across data in all sorts of different formats. The following table can help you understand common bioinformatics formats and what you can and cannot do with them.
| Format Name |
Description |
| RAW |
Sequence format that doesn't contain any header. Spaces and
numbers are usually tolerated. |
| FASTA |
This is the default format. Sequence format that contains a
header line and the sequence: >name
AGCTGTGTGGGTTGGTGGGTT |
| PIR |
Sequence format that's similar to FASTA but less common |
| MSF |
Multiple sequence alignment format |
| CLUSTAL |
Multiple sequence alignment format (works with T-Coffee) |
| TXT |
Text format |
| GIF, JPEG, PNG, PDF |
Graphic formats. Do not use them to store important
information. |

Biology Glossary
anemia
A low number of red blood cells or low level of hemoglobin; may be caused by dietary deficiencies, metabolic disorders, hereditary conditions, or damaged bone marrow.

Biology Glossary
antigen
A foreign substance in the body that causes an immune response.

Biology Glossary
body mass index
The BMI is the result of a formula that uses your weight and height to determine whether you need to lose weight.

Biology Glossary
carbohydrates
Energy-packed compounds consisting of carbon, hydrogen, and oxygen that provide quick fuel for organisms.

Biology Glossary
cellulose
A form of carbohydrate that has a structural role in living organisms (animals and plants).

Biology Glossary
centrifuge
A machine that is used to separate blood cells and platelets from plasma.

Biology Glossary
chloroplasts
Plant cells that use energy from sunlight to create food.

Biology Glossary
cytoplasm
The fluid contained within animal cells. Also called plasma.

Biology Glossary
disaccharides
Carbohydrate molecules in which 2 monosaccharide molecules are joined together. Disaccharides consist of 6 to 14 carbon atoms.

Biology Glossary
DNA
Stands for deoxyribonucleic acid. Large molecules found in all living things that carry genetic information.

Biology Glossary
electron microscope
A high-powered, expensive device that uses beams of electrons to bring the finest details of cells into focus.

Biology Glossary
endocrine system
A system of glands that secrete different types of hormones that help regulate organisms.

Biology Glossary
endoplasmic reticulum
The ER is a series of canals that connects the nucleus of animal cells to the cytoplasm outside those cells.

Biology Glossary
equilibrium
The state of a chemical reaction in which the amounts on each side of the reaction have stabilized.

Biology Glossary
eukaryotes
Organisms — including plants and animals, as well as fungi, protozoa, and most algae — with cells that contain a nucleus and chromosomes.

Biology Glossary
Golgi apparatus
A component within cells that packages and distributes hormones, enzymes, and other cell products to other organelles or outside the cell.

Biology Glossary
hemoglobin
An iron-containing molecule in red blood cells that carries oxygen around the body.

Biology Glossary
heterotrophs
Animals — including herbivores, carnivores, and omnivores — that feed on other living organisms.

Biology Glossary
homeostasis
The processes used by the body to constantly achieve and maintain balance.

Biology Glossary
integument
The skin or outer surface of an animal. Small animals such as earthworms use integumentary exchange to exchange gases with the environment.

Biology Glossary
Krebs cycle
A method of describing the steps involved in the chemical process of respiration.

Biology Glossary
lipoproteins
Compounds such as HDL and LDL that carry cholesterol through the bloodstream; made from a fat (lipid) and a protein.

Biology Glossary
lysosomes
Specialized cellular organelles formed by the Golgi apparatus that help to clean up the cell by breaking down harmful cell products and removing dead organelles.

Biology Glossary
maceration
A process, such as chewing, that physically breaks down food into pieces.

Biology Glossary
matrix
The extracellular fluid in which animal cells float.

Biology Glossary
mitochondria
An organelle in animal cells that combines food with oxygen to supply energy to cells.

Biology Glossary
monosaccharides
Carbohydrate molecules in which simple sugars consist of three to seven carbon atoms.

Biology Glossary
nuclear membrane
A two-layer structure that separates the nucleus from the cytoplasm in animal cells.

Biology Glossary
organelles
Structures that float inside the fluid of cells; used during metabolic processes.

Biology Glossary
osmosis
A mechanism that moves water and nutrients into and throughout a plant.

Biology Glossary
peristalsis
The action of food being moved down the esophagus and through the entire digestive tract.

Biology Glossary
peroxisomes
Sacs of enzymes within animal cells that help protect the cell by breaking down accumulations of toxic products such as hydrogen peroxide.

Biology Glossary
photosynthesis
The biochemical process that plants use to acquire energy from the sun.

Biology Glossary
plasma membrane
The membrane that holds fluid within animal cells. Also called the cell membrane.

Biology Glossary
polysaccharides
Carbohydrate molecules that are formed by many long chains of monosaccharides.

Biology Glossary
prokaryotes
Organisms — such as bacteria and blue-green algae — with cells that do not contain a nucleus.

Biology Glossary
ribosomes
Components within cells that assist in making proteins from amino acids.

Biology Glossary
RNA
Stands for ribonucleic acid. In animals, works with DNA to produce proteins needed throughout the body.

Biology Glossary
ruminants
Mammals — such as cattle, sheep, and goats — that can break down and digest cellulose.