Advertisement

Cheat Sheet

Bioinformatics For Dummies

From Bioinformatics For Dummies, 2nd Edition by Jean-Michel Claverie, Cedric Notredame

Bioinformatics is the marriage of molecular biology and information technology. Web sites direct you to basic bioinformatics data and get down to specifics in helping you analyze DNA/RNA and protein sequences. All this data comes at you in several formats, so becoming familiar with various format types helps you know how to interpret and store the data.

Where to Find Bioinformatics Data

Bioinformatics combines information technology and molecular biology, so it makes sense that the Internet is the main arena for pursuing bioinformatics information. The following list offers links to helpful Web sites around the world and the areas that they specialize in:

Bioinformatics Web Sites for Analyzing DNA/RNA Sequences

The bioinformatics Web sites in the following list offer help in analyzing DNA and RNA sequences. And, in the marriage of information technology and molecular biology that is bioinformatics, this type of analysis is what it's all about.

Bioinformatics Web Sites for Analyzing Protein Sequences

With bioinformatics you can explore molecular biology using information technology. The links to the Web sites in the following list focus on protein sequences. Some offer searchable databases, others help you investigate a single protein; all are helpful:

Bioinformatics Data Formats

When you're using the Internet to help with your bioinformatics project, you come across data in all sorts of different formats. The following table can help you understand common bioinformatics formats and what you can and cannot do with them.

Format Name Description
RAW Sequence format that doesn't contain any header. Spaces and numbers are usually tolerated.
FASTA This is the default format. Sequence format that contains a header line and the sequence: >name
AGCTGTGTGGGTTGGTGGGTT
PIR Sequence format that's similar to FASTA but less common
MSF Multiple sequence alignment format
CLUSTAL Multiple sequence alignment format (works with T-Coffee)
TXT Text format
GIF, JPEG, PNG, PDF Graphic formats. Do not use them to store important information.
blog comments powered by Disqus
Advertisement
Advertisement

Inside Dummies.com